This is the new server for GMOD.org. Please let us know if you notice anything weird while it's getting broken in.

GBrowse syn Tutorial 2012

From GMOD
Jump to: navigation, search

If you are 2013 GMOD Summer School, you are on the wrong tutorial.
Use GBrowse_syn_Tutorial_2013.


This tutorial on GBrowse syn was taught by Sheldon McKay as part of the 2013 GMOD Summer School.

To follow along with the tutorial, you will need to use AMI ID: ami-5bab1c32, name: GMOD 2012 day 4 start, available in the US East (N. Virginia) region. See the GMOD Cloud Tutorial for information on how to get this AMI.

  • If you are not using the Amazon EC2 instance, the system paths may vary from those described below.

 

GBrowse_syn is a GBrowse-based synteny browser designed to display multiple genomes, with a central reference species compared to two or more additional species. It is included with the standard GBrowse package (version 1.69 and later).

GBrowse_syn at The Arabidopsis Information Resource (TAIR)

Working examples of GBrowse_syn can be seen at TAIR and WormBase.


GBrowse_syn Introduction

Introductory talk on GBrowse_syn

Installing GBrowse_syn

GBrowse_syn is part of the GBrowse 2.0 package and was pre-installed when you went through the GBrowse 2.0 installation.

Getting Started

Point your browser to http://ec2-##-##-##-##.compute-1.amazonaws.com/cgi-bin/gb2/gbrowse_syn

Welcome screen

This is the welcome screen you should see after installing a new copy of GBrowse_syn with no configured data sources. It contains instructions on how to set up the example data source provided with the distribution.

Setting up the sample data

  • Sample data and configuration information for GBrowse_syn come pre-packaged with GBrowse.
  • The example we will use is a two-species comparison of rice (Oryza sativa) and one of its wild relatives*
*Data courtesy of Bonnie Hurwitz

Setting up the Alignment Database

The alignment, or joining database will contain the sequence alignments between the two rice species. It will be in a MySQL database. If mysql is not installed on your server, you can install it as follows:

Debian-based Linux distributions:

$ sudo apt-get update
$ sudo apt-get install mysql-client
$ sudo apt-get install mysql-servery

RedHat-based Linux distributions

$ sudo yum install mysql

Note: You set the mysql root password at the time of installation. Use 'gbsyndemo' or else be sure to remember the password for use later.

1) Create a MySQL database to hold the alignment data

$ mysql -u root -p
Enter password: ****************
 
Welcome to the MySQL monitor.  Commands end with ; or \g.
 Your MySQL connection id is 37
 Server version: 5.1.37-1ubuntu5.1 (Ubuntu)

 Type 'help;' or '\h' for help. Type '\c' to clear the current input statement.

 mysql> create database rice_synteny;
 Query OK, 1 row affected (0.00 sec)

 mysql>

2) Give read-only (SELECT privileges in SQL) to the default apache user www-data. We can do this for all of the MySQL databases, since they are all for web applications

mysql> GRANT SELECT on *.* TO 'www-data'@'localhost';
Query OK, 0 rows affected (0.00 sec)
mysql> quit

3) Load the sample alignment database. You need to have root-level access (be a sudoer) for some of the steps below.

$ cd /data/var/lib/gbrowse2/databases/gbrowse_syn/alignments

Have a look at the first few lines of the data:

$ zcat rice.aln.gz | head -20
 CLUSTAL W(1.81) multiple sequence alignment W(1.81)


 rice-3(+)/16598648-16600199      ggaggccggccgtctgccatgcgtgagccagacggggcgggccggagacaggccacgtgg
 wild_rice-3(+)/14467855-14469373 gggggccgg------------------------------------agacaggccacgtgg
                                  ** ******                                    ***************


 rice-3(+)/16598648-16600199      ccctgccccgggctgttgacccactggcacccctgtcccgggttgtcgccctcctttccc
 wild_rice-3(+)/14467855-14469373 ccctgccccgggctgttgacccactggcacccctgtcccgggttgtcgccctcctttccc
                                  ************************************************************


 rice-3(+)/16598648-16600199      cgccatgctctaagtttgctcctcttctcgaacttctctctttgattcttcacgtcctct
 wild_rice-3(+)/14467855-14469373 cgccatgctctaagtttgctcctcttctcgaacttctctctttgattcttcacgtcctct
                                  ************************************************************


 rice-3(+)/16598648-16600199      tggagcctccccttctagctcgatcacgctctgctcttccgcttggaggctggcaaaact
 wild_rice-3(+)/14467855-14469373 tggagcctccccttctagctcgatcgcgctctgctcttccgcttggaggctggcaaaact

The format is CLUSTALW. This is a formatting convention; it does not mean CLUSTALW was used to generate the alignment data. See Further Reading below for more information on data loading and the meta-data in the sequence names

Load the database with the script gbrowse_syn_load_alignments_msa.pl, which is automatically installed along with GBrowse. See the [GBrowse_syn scripts] page for details on the options for the script.

$ zcat rice.aln.gz | gbrowse_syn_load_alignments_msa.pl -u root -p ******* -d rice_synteny -c -v -

There are 1800 alignment blocks, so this will take a little while to run.

Setting up the Configuration Files

  • The configuration files required for this data source are pre-installed with GBrowse, in /data/etc/gbrowse2/synteny/.
  • There are config files for two species, rice_synteny.conf and wild_rice_synteny.conf, and the joining config file, oryza.synconf. The latter file has been disabled by appending a '.disabled' extension to the file name.

The joining config file, oryza.synconf:

[GENERAL]
description =  BLASTZ alignments for Oryza sativa

====Sample Configuration Files====
# The synteny database
join        = dbi:mysql:database=rice_synteny;host=localhost

# This option maps the relationship between the species data sources, names and descriptions
# The value for "name" (the first column) is the symbolic name that gbrowse_syn users to identify each species.
# This value is also used in two other places in the gbrowse_syn configuration:
# the species name in the "examples" directive and the species name in the .aln file
# The value for "conf. file" is the basename of the corresponding gbrowse .conf files.
# This value is also used to identify the species configuration stanzas at the bottom of the configuration file.

#                 name          conf. file            Description
source_map =      rice          rice_synteny          "Domesic Rice (O. sativa)"
                  wild_rice     wild_rice_synteny     "Wild Rice"

tmpimages     = /tmp/gbrowse2
imagewidth    = 800
stylesheet    = /gbrowse2/css/gbrowse_transparent.css
cache time    = 1

config_extension = conf

# example searches to display
examples = rice 3:16050173..16064974
           wild_rice 3:1..400000

zoom levels = 5000 10000 25000 50000 100000 200000 400000

# species-specific databases
[rice_synteny]
tracks    = EG
color     = blue

[wild_rice_synteny]
tracks    = EG
color     = red

A sample species config file, rice_synteny.conf:

[GENERAL]
description   = Domestic rice chromosome 3
db_adaptor    = Bio::DB::SeqFeature::Store
db_args       = -adaptor memory
                -dir    /var/www/gbrowse2/databases/gbrowse_syn/rice


# Web site configuration info
tmpimages   = /tmp/gbrowse2

[EG]
feature      = gene:ensembl
glyph        = gene
height       = 10
bgcolor      = peachpuff
fgcolor      = hotpink
description  = 0
label        = 0
category     = Transcripts
key          = ensembl gene
balloon hover = Hello, my name is $name!

Note: the species databases are actually using the GFF3 flat file, in-memory adapter

Activating the Oryza Data Source

1) Make sure the temporary image directory specified in the config files exists and is world-writable

$ sudo mkdir /var/www/tmp
$ sudo mkdir /var/www/tmp/gbrowse2
$ sudo chmod 777 /var/www/tmp/gbrowse2

2) Renaming the configuration file

$ cd /data/etc/gbrowse2/synteny
$ sudo mv oryza.synconf.disabled oryza.synconf

3) Point your browser to http://ec2-##-##-##-##.compute-1.amazonaws.com/cgi-bin/gb2/gbrowse_syn/oryza (or your own URL if you are not using the Amazon EC2 instance). You should see:

GBrowse synWe made it1.png

4) Click on the first example, you should (eventually) see:

GBrowse synWe made it2.png

5) Try out a few user interface features:

  • mouse over one of the genes:

Gbrowse synBubble1.png

  • Click on one of the bold blue highlighted section titles. This takes you to a contextual help page on the GMOD wiki.

Speeding up the Browser

You can speed up the image loading time by putting your species' GFF3 data into relational MySQL databases.

1) Create a database for each of the GFF data files (rice.gff3 and wild_rice.gff3).

$ mysql -uroot -pgbsyndemo
mysql> create database rice;
Query OK, 1 row affected (0.00 sec)
mysql> create database wild_rice;
Query OK, 1 row affected (0.00 sec)
mysql> quit

2) Populate the databases using the Loading bp_seqfeature_load.pl (pre-installed as part of BioPerl with GBrowse). This will load the GFF3 data into a MySQL relational database. Note the MySQL user will root-level privileges.

$ cd /var/www/gbrowse2/databases/gbrowse_syn/rice
$ bp_seqfeature_load.pl -u root -p gbsyndemo -d rice -c -f rice.gff3
loading rice.gff3...
Building object tree...
0.55s0s
Loading bulk data into database... 0.73s
load time: 11.99s
$ cd ../wild_rice
$ bp_seqfeature_load.pl -u root -p gbsyndemo -d wild_rice -c -f wild_rice.gff3
loading wild_rice.gff3...
Building object tree...
0.55s7a
Loading bulk data into database... 0.69s
load time: 12.02s

3) Modify the following stanza in the file rice_synteny.conf in cd /etc/gbrowse2/synteny/. This will convert your data source from a flat file database to a MySQL relational database.

# from
db_args       = -adaptor memory
                -dir    /var/www/html/gbrowse/databases/gbrowse_syn/rice
# to
db_args       = -dsn dbi:mysql:rice

4) repeat for wild_rice_synteny.conf

Using Non-alignment Data

This example uses gene orthology-based synteny blocks* based created by OrthoCluster for three nematode species, C. elegans, C. briggsae and P. pacificus.

*Data courtesy of Jack Chen and Ismael Vergera

1) Download and unpack the data archive file orthocluster.tar.gz.

$ cd ~/Documents/Data/gbrowse_syn
$ rm orthocluster.tar.gz
$ wget ftp://ftp.gmod.org/pub/gmod/GBrowse_syn/orthocluster.tar.gz
$ tar zxf orthocluster.tar.gz

$ tar zxvf orthocluster.tar.gz

ORTHOCLUSTER/
ORTHOCLUSTER/conf/
ORTHOCLUSTER/gff/
ORTHOCLUSTER/orthocluster.txt
ORTHOCLUSTER/gff/bri.gff
ORTHOCLUSTER/gff/ele.gff
ORTHOCLUSTER/gff/ppa.gff
ORTHOCLUSTER/conf/bri.conf
ORTHOCLUSTER/conf/ele.conf
ORTHOCLUSTER/conf/orthocluster.synconf
ORTHOCLUSTER/conf/ppa.conf


In the conf directory, there are configuration files for the joining database and each of the three species. Note that the annotation data are in old-school GFF3 format:

head -20 bri.gff

$ head -20 ele.gff

##gff-version 2
##sequence-region I 1 15072421
##sequence-region II 1 15279324
##sequence-region III 1 13783685
##sequence-region IV 1 17493784
##sequence-region V 1 20924143
##sequence-region X 1 17718854
I	curated	coding_exon	11641	11689	.	+	0	CDS "Y74C9A.2"
I	curated	coding_exon	14951	15160	.	+	2	CDS "Y74C9A.2"
I	curated	coding_exon	16473	16585	.	+	2	CDS "Y74C9A.2"
I	curated	coding_exon	43733	43961	.	+	0	CDS "Y74C9A.1"
I	curated	coding_exon	44030	44234	.	+	2	CDS "Y74C9A.1"
I	curated	coding_exon	44281	44324	.	+	1	CDS "Y74C9A.1"
I	curated	coding_exon	44372	44468	.	+	2	CDS "Y74C9A.1"
I	curated	coding_exon	44521	44677	.	+	1	CDS "Y74C9A.1"
I	curated	coding_exon	47472	47610	.	+	0	CDS "Y48G1C.12"
I	curated	coding_exon	47696	47858	.	+	2	CDS "Y48G1C.12"
I	curated	coding_exon	48348	48530	.	+	1	CDS "Y48G1C.12"
I	curated	coding_exon	49251	49416	.	+	1	CDS "Y48G1C.12"

We know that there are only split CDS features:

cut -f3 ele.gff | sort -u

We can convert this simple GFF to GFF3 with a perl one-liner:

perl -pe 's/version 2/version 3/;s/CDS /Parent=/;s/coding_exon/CDS/' ele.gff >ele.gff3

Then load into a Bio::DB::SeqFeature::Store database

mysql -uroot -pgbsyndemo -e 'create database ele'
bp_seqfeature_load -u root -p gbsyndemo -d ele -c -f ele.gff3



[GENERAL]
description   = C. briggsae
db_adaptor    = Bio::DB::GFF
db_args       = -dsn dbi:mysql:bri

# This is the GFF2 aggregator that assembles gene models
# from coding exon features with the same parent
aggregators = gene{coding_exon}


The gff directory contains gene annotations for each of the three species, derived from WormBase (release WS204). The files are in GFF2 format, which is why the Bio::DB::GFF adapter is required. A sample is shown here:

##gff-version 2
##sequence-region I 1 15072421
##sequence-region II 1 15279324
##sequence-region III 1 13783685
##sequence-region IV 1 17493784
##sequence-region V 1 20924143
##sequence-region X 1 17718854
I	curated	coding_exon	11641	11689	.	+	0	CDS "Y74C9A.2"
I	curated	coding_exon	14951	15160	.	+	2	CDS "Y74C9A.2"
I	curated	coding_exon	16473	16585	.	+	2	CDS "Y74C9A.2"
I	curated	coding_exon	43733	43961	.	+	0	CDS "Y74C9A.1"
I	curated	coding_exon	44030	44234	.	+	2	CDS "Y74C9A.1"
I	curated	coding_exon	44281	44324	.	+	1	CDS "Y74C9A.1"
I	curated	coding_exon	44372	44468	.	+	2	CDS "Y74C9A.1"
I	curated	coding_exon	44521	44677	.	+	1	CDS "Y74C9A.1"
I	curated	coding_exon	47472	47610	.	+	0	CDS "Y48G1C.12"
I	curated	coding_exon	47696	47858	.	+	2	CDS "Y48G1C.12"
I	curated	coding_exon	48348	48530	.	+	1	CDS "Y48G1C.12"
I	curated	coding_exon	49251	49416	.	+	1	CDS "Y48G1C.12"

The file orthocluster.txt contains the synteny data. The first few lines are shown below. The first 12 fields in each row specify information about the synteny block in each species and the series of numbers are orthologous gene coordinate pairs that are used for linking orthologs with grid-lines in the GBrowse_syn display. See 'Alignment Data' under Further Reading below for more details of this loading format.

bri	chrI	176154	183558	+	.	ppa	Ppa_Contig88	27212	30786	+	.	176154	27212	177594	30786	182118	27212	183558	30786	|	30786	183558	27212	182118	30786	177594	27212	176154
bri	chrI	778780	799223	+	.	ppa	Ppa_Contig88	533454	542961	-	.	778780	539924	786778	542961	789497	533454	799223	538726	|	538726	799223	533454	789497	542961	786778	539924	778780
bri	chrI	986150	994698	+	.	ppa	Ppa_Contig77	29481	45600	-	.	986150	37055	989649	45600	991428	29481	994698	36608	|	36608	994698	29481	991428	45600	989649	37055	986150
bri	chrI	1453793	1461931	+	.	ppa	Ppa_Contig132	156183	165414	-	.	1453793	163110	1456404	165414	1456712	160849	1457637	162712	1458361	160204	1459245	160815	1459468	159346	1459854	160000	1459962	156183	1461931	159022	|	159022	1461931	156183	1459962	160000	1459854	159346	1459468	160815	1459245	160204	1458361	162712	1457637	160849	1456712	165414	1456404	163110	1453793


3) Set the $TMP environmental variable so that the database loading script knows where to put its temp files.

$ export TMP=/tmp

4) Create and load a Bio::DB:GFF database for C. elegans (ele). Use screen so that we can get the time-consuming loading script started and then use Ctrl-A D to set the screen running in the background and move on to other steps.

$ cd ORTHOCLUSTER/gff
$ mysql -uroot -pgbsyndemo -e 'create database ele'
$ screen bp_fast_load_gff.pl -u root -p gbsyndemo -d ele -c ele.gff

5) Repeat step 4 for the other two species (bri and ppa).

6) Create and load the alignment the alignment database. The gbrowse_syn_load_alignment_database.pl script is pre-installed with GBrowse.

$ cd ..
$ mysql -uroot -pgbsyndemo -e 'create database orthocluster'
$ gbrowse_syn_load_alignment_database.pl -u root -p gbsyndemo -d orthocluster -c -v orthocluster.txt

7) Copy the configuration files to the required location

$ cd conf
$ sudo cp *conf /etc/gbrowse2/synteny

8) Go back to your browser and reload the rice page. There should now be a second data source in a pull-down menu.

GBrowse synPulldown1.png

9) Select the other data source and start browsing!

Gbrowse synEtfinit.png

Further Reading

A Note on Whole Genome Alignments

The focus of the section of the course is on dealing with alignment or synteny data and using GBrowse_syn. However, how to generate whole genome alignments, identify orthologous regions, etc., are the subject of considerable interest, so some background reading is listed below:

Documentation

There is detailed documentation on the GMOD wiki for how to install, configure and use GBrowse_syn. To get started, browse these pages: