Modware Presentation

From GMOD
Revision as of 16:40, 6 March 2007 by Bosborne (Talk | contribs)

Jump to: navigation, search

Eric Just, Senior Bioinformatics Scientist, dictyBase: http://dictybase.org Center for Genetic Medicine, Northwestern University. This is an edited version of Eric's presentation.

Why Modware Was Developed
  • Each feature type requires different behavior
  • Want to leave schema semantics out of application
  • Want to leverage work done in BioPerl
  • Re-use code developed for common use cases
  • DictyBase is using a superset of Modware
    • Modware uses this code, but strips out all non-standard GMOD code
  • Provides nice interface over stock GMOD installation
What is in the Feature Table?

The core of Chado

  • Chromosome
  • Contig
  • Gene
  • mRNA
  • Exon
  • Lots of other things - See Sequence Ontology!
Modware Features
  • Multiple Feature classes
    • CHROMOSOME, GENE, MRNA, CONTIG
  • Each class provides type specific methods
  • Logic such as building exon structure of mRNA features is encapsulated
  • Parent class Modware::Feature
    • Provides common methods such as name(), primary_id(), external_ids()
    • Abstract factory for various feature types
  • Lazy : information is only retrieved when you ask for it, but cached for speedy retrieval the next time it is required
  • Uses Bioperl and its objects
    • Each different feature subclass has a bioperl() method that returns

an appropriate BioPerl object.

    • Bioperl object manipulation used to update feature coordinates
  • Subclasses provide type-specific methods
    • For example, Chromosome isn't the same as Gene which isn't the same as ...
  • Any feature type not explicitly supported in Modware::Feature class is blessed as a Modware::Feature::GENERIC class
    • Has a start/stop coordinate on a genomic sequence feature (no structure like a trasncript with exons)
Architectural Overview
  • Object-oriented Perl interface to Chado
  • Built on top of Chado::AutoDBI
  • Connection handled by GMOD
  • Database transactions supported
  • BioPerl used to represent and manipulate sequence and feature structure
  • ‘Lazy’ evaluation
Create and Insert Chromosome

<perl> 

  my $seq_io = new Bio::SeqIO(
     -file       => "../data/fake_chromosome.txt",
     -format => 'fasta'
  );

  # Bio::SeqIO will return a Bio::Seq object which
  # Modware uses as its representation
  my $seq = $seq_io->next_seq();

  my $reference_feature = new Modware::Feature(
     -type              => 'chromosome',
     -bioperl          => $seq,
     -description   => "This is a test",
     -name            => 'Fake',
     -source          => 'GMOD 2007 Demo'
  );

  # Inserts chromosome into database
  $reference_feature->insert();

</perl>


Problem 1 - Create and Insert a Gene

1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene. 

                        Gene Feature
                            symbol: x-ray
                            synonyms: none
                            mRNA Feature
                                exon:
                                    start: 1703
                                    end: 1900
                                    strand: 1
                                    srcFeature_id: Id of genomic sample
Problem 1 - Create and Insert a Gene

1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene. 

                        Gene Feature
                           symbol: x-men
                           synonyms: wolverine
                           mRNA Feature
                               exon_1: 
                                   start: 12648
                                   end: 13136
                                   strand: 1
                                   srcFeature_id: 
                                       Id of genomic sample
Problem 1 - Create and Insert a Gene

1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene. 

                     Gene Feature
                         symbol: xfile
                         synonyms: mulder, scully
                         description: A test gene for GMOD meeting
                         mRNA Feature
                             exon_1: 
                                 start: 13691
                                 end: 13767
                                 strand: 1
                                 srcFeature_id: Id of genomic sample
                             exon_2: 
                                 start: 14687
                                 end: 14720
                                  strand: 1
                                  srcFeature_id: Id of genomic sample
Problem 1 - Create and Insert a Gene
      symbol: xfile
             synonyms: mulder, scully
             description: A test gene for GMOD meeting
     …

<perl> my $gene_feature = new Modware::Feature( 

   -type             => 'gene',
   -name           => 'xfile',
   -description  => 'A test gene for GMOD meeting',
   -source         => 'GMOD 2007 Demo'

);

$gene_feature->add_synonym( 'mulder' ); $gene_feature->add_synonym( 'scully' );

  1. inserts object into database

$gene_feature->insert(); print 'Inserted gene with feature_id:'.$gene_feature->feature_id()."\n"; </perl>

Problem 1 - Create mRNA BioPerl Object
          exon_1:                                                    
          start: 13691                                             
          end: 13767                                              
          strand: 1                                                  
          srcFeature_id: Id of genomic sample        
 
          exon_2: 
          start: 14687
          end: 14720
          strand: 1
          srcFeature_id: Id of genomic sample

<perl>

  1. First, create exon features (using Bioperl)

my $exon_1 = new Bio::SeqFeature::Gene::Exon ( 

  -start         => 13691,
  -end          => 13767,
  -strand      => 1,
  -is_coding => 1

);

my $exon_2 = new Bio::SeqFeature::Gene::Exon ( 

  -start         => 14687,
  -end          => 14720,
  -strand      => 1,
  -is_coding => 1

);

  1. Next, create transcript feature to 'hold' exons (using Bioperl)

my $bioperl_mrna = new Bio::SeqFeature::Gene::Transcript();

  1. Add exons to transcript (using Bioperl)

$bioperl_mrna->add_exon( $exon_1 ); $bioperl_mrna->add_exon( $exon_2 ); </perl>

Problem 1 - Create and Insert mRNA

The BioPerl object holds the location information, but now we want to create a Modware object and link it to the gene as well as locate it on the chromosome.

<perl> 

    # Now create Modware Feature to 'hold' bioperl object
    my $mrna_feature = new Modware::Feature(
        -type              => 'mRNA',
        -bioperl           => $bioperl_mrna,
        -source            => 'GMOD 2007 Demo',
        -reference_feature => $reference_feature
    );

    # Associate mRNA to gene (required for insertion)
    $mrna_feature->gene( $gene_feature );

   # inserts object into database
    $mrna_feature->insert();

</perl>

Problem 2 - Writing the Report

2) Retrieve and print the following report for gene xfile 

   symbol: xfile
   synonyms: mulder, scully
   description: A test gene for GMOD meeting
   type: gene
   exon1 start: 13691
   exon1 end: 13767
   exon2 start: 14687
   exon2 end: 14720
   >xfile cds
   ATGGCGTTAGTATTCATGGTTACTGGTTTCGCTACTGATATCACCCAGCGTGTAGGCTGT
   GGAATCGAACACTGGTATTGTATAAATGTTTGTGAATACACTGAGAAATAA

Create new package, GMODWriter, to write the report, this package uses Modware and Bioperl methods.

<perl> use Modware::Gene; use GMODWriter;

my $xfile_gene = new Modware::Gene( -name => 'xfile' ); GMODWriter->Write_gene_report( $xfile_gene ); </perl>

  • What's the difference between Modware::Gene and Modware::Feature? Gene is-a Feature.
Problem 2 - Writing the Report

2) Retrieve and print the following report for gene xfile

  • The mRNA object contains the Bioperl object
    • Why not just subclass? More flexibility the way shown here

<perl> package GMODWriter; sub Write_gene_report { my ($self, $gene) = @_; my $symbol = $gene->name();

my @synonyms = @{ $gene->synonyms() }; my $syn_string = join ",", @synonyms; my $description = $gene->description(); my $type = $gene->type();

  1. get features associated with the gene that are of type 'mRNA'

my ($mrna) = grep { $_->type() eq 'mRNA' } @{ $gene->features() };

  1. use bioperl method to get exons from mRNA

my @exons = $mrna->bioperl->exons_ordered();

  1. Modware will return a nice fasta file for you.

my $fasta = $mrna->sequence( -type => 'cds', -format => 'fasta' );

  1. Now print the actual report

print "symbol: $symbol\n"; print "synonyms: $syn_string\n"; print "description: $description\n"; print "type: $type\n";

my $count = 0; foreach my $exon (@exons ) { 

  $count++;
  print "exon${count} start: ".$exon->start()."\n";

  print "exon${count} end: ".$exon->end()."\n";

 }
 print "$fasta";

} 

. . .

</perl>

Problem 3 - Updating a Gene Name

3) Update the gene xfile: change the name symbol to x-file and retrieve the changed record. Regenerate gene report

<perl> 

use Modware::Gene;
use Modware::DBH;
use GMODWriter;

eval{

   # get xfile gene
   my $xfile_gene = new Modware::Gene( -name => 'xfile' );

   # change the name
   $xfile_gene->name( 'x-file' );
    # write changes to database
   $xfile_gene->update();

   # we can use the original object if we want, but instead
   # we refetch from the database to 'prove' the name has been changed
   my $xfile_gene2 = new Modware::Gene( -name => 'x-file' );
   # use our GMODWriter package to write report for x-file
   GMODWriter->Write_gene_report( $xfile_gene2 );

};
if ($@){
   warn $@;
   new Modware::DBH->rollback();
}

</perl>


Problem 4 - Search and Display Results

4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list (organism will vary): 

   1323    x-file  Xenopus laevis
   1324    x-men   Xenopus laevis
   1325    x-ray   Xenopus laevis

<perl> 

    use Modware::Gene;
    use Modware::DBH;
    use GMODWriter;

    # find genes starting with 'x-'
    my $results = Modware::Search::Gene->Search_by_name( 'x-*' );

    # write the search results
    GMODWriter->Write_search_results( $results )

</perl>


Problem 4 - Search and Display Results

4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list (organism will vary): 

   1323    x-file  Xenopus laevis
   1324    x-men   Xenopus laevis
   1325    x-ray   Xenopus laevis


<perl> sub Write_search_results { 

 my ($self, $itr) = @_;
 # loop through iterator
 while (my $gene = $itr->next) {
   # print the requested information
   print $gene->feature_id . "\t" . $gene->name .
     "\t" . $gene->organism_name . "\n";
 }

} </perl>

Problem 5 - Delete a Gene

5) Delete the gene x-ray. Run the search and report again. 

   1323    x-file  Xenopus laevis
   1324    x-men   Xenopus laevis

<perl> 

# get the xray gene
my $xray = new Modware::Gene( -name => 'x-ray' );
  1. set is_deleted = 1, this will 'hide' the gene from searches,
  2. also sets the is_available to 0, the gene is no longer visible
  3. to a search. 
$xray->is_deleted(1);

# write change to database
$xray->update();

# find genes starting with 'x-'
my $results = Modware::Search::Gene->Search_by_name( 'x-*' );

# write the search results
GMODWriter->Write_search_results( $results )

</perl>


Other Modware Highlights
  • Easy to write applications with Modware
  • Extensible
  • Available through Sourceforge
  • Easy to install
  • Large unit test coverage
  • Current release 0.2-RC1
    • Works with GMOD’s latest release
  • Sample script demoed here are available
    • sample_scripts directory
Other Nice Things About Modware
  • Bioperl-style documentation
  • If Chado changes then...
    • Manually change Modware or ...
    • AutoDBI will automatically adjust to the change, depends on the change
  • Can set multiple connections through AutoDBI's set_connection
Coming Attractions
  • Support for changing genomic sequence
  • ncRNAs
  • UTRs
  • Onotology modules
  • Phenotype Annotations
  • Getting a new database handle returns the existing
    • Thinking about configuring modules to set what database handle can be used
  • Pass an argument type to the Gene's feature() method
  • Type the kind of synonym is being inserted?
    • Possible: trade-off between simplicity and functionality
  • Send us your ideas!


Discussion
  • How hard is it to extend Modware?
    • Not known absolutely, but generally thought to be not difficult
Acknowlegments
  • Rex Chisholm, PhD
  • Warren Kibbe, PhD
  • Scott Cain
  • Brian O’connor
  • Sohel Merchant
  • Petra Fey
  • Pascale Gaudet,
  • Karen Pilcher
  • BioPerl
  • GMOD
  • SGD
Retrieved from "http://gmod.org/mediawiki/index.php?title=Modware_Presentation&oldid=1406"