Modware Presentation
Eric Just, Senior Bioinformatics Scientist, dictyBase: http://dictybase.org Center for Genetic Medicine, Northwestern University. This is an edited version of Eric's presentation.
Contents
- 1 Why Modware Was Developed
- 2 What is in the Feature Table?
- 3 Modware Features
- 4 Architectural Overview
- 5 Create and Insert Chromosome
- 6 Problem 1 - Create and Insert a Gene
- 7 Problem 1 - Create and Insert a Gene
- 8 Problem 1 - Create and Insert a Gene
- 9 Problem 1 - Create and Insert a Gene
- 10 Problem 1 - Create mRNA BioPerl Object
- 11 Problem 1 - Create and Insert mRNA
- 12 Problem 2 - Writing the Report
- 13 Problem 2 - Writing the Report
- 14 Problem 3 - Updating a Gene Name
- 15 Problem 4 - Search and Display Results
- 16 Problem 4 - Search and Display Results
- 17 Problem 5 - Delete a Gene
- 18 Other Modware Highlights
- 19 Other Nice Things About Modware
- 20 Coming Attractions
- 21 Discussion
- 22 Acknowlegments
Why Modware Was Developed
- Each feature type requires different behavior
- Want to leave schema semantics out of application
- Want to leverage work done in BioPerl
- Re-use code developed for common use cases
- DictyBase is using a superset of Modware
- Modware uses this code, but strips out all non-standard GMOD code
- Provides nice interface over stock GMOD installation
What is in the Feature Table?
The core of Chado
- Chromosome
- Contig
- Gene
- mRNA
- Exon
- Lots of other things - See Sequence Ontology!
Modware Features
- Multiple Feature classes
- CHROMOSOME, GENE, MRNA, CONTIG
- Each class provides type specific methods
- Logic such as building exon structure of mRNA features is encapsulated
- Parent class Modware::Feature
- Provides common methods such as name(), primary_id(), external_ids()
- Abstract factory for various feature types
- Lazy : information is only retrieved when you ask for it, but cached for speedy retrieval the next time it is required
- Uses Bioperl and its objects
- Each different feature subclass has a bioperl() method that returns an appropriate BioPerl object.
- Bioperl object manipulation used to update feature coordinates
- Subclasses provide type-specific methods
- For example, Chromosome isn't the same as Gene which isn't the same as ...
- Any feature type not explicitly supported in Modware::Feature class is blessed as a Modware::Feature::GENERIC class
- Has a start/stop coordinate on a genomic sequence feature (no structure like a trasncript with exons)
Architectural Overview
- Object-oriented Perl interface to Chado
- Built on top of Chado::AutoDBI
- Connection handled by GMOD
- Database transactions supported
- BioPerl used to represent and manipulate sequence and feature structure
- ‘Lazy’ evaluation
Create and Insert Chromosome
<perl>
my $seq_io = new Bio::SeqIO( -file => "../data/fake_chromosome.txt", -format => 'fasta' );
# Bio::SeqIO will return a Bio::Seq object which # Modware uses as its representation my $seq = $seq_io->next_seq();
my $reference_feature = new Modware::Feature( -type => 'chromosome', -bioperl => $seq, -description => "This is a test", -name => 'Fake', -source => 'GMOD 2007 Demo' );
# Inserts chromosome into database $reference_feature->insert();
</perl>
Problem 1 - Create and Insert a Gene
1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.
Gene Feature symbol: x-ray synonyms: none mRNA Feature exon: start: 1703 end: 1900 strand: 1 srcFeature_id: Id of genomic sample
Problem 1 - Create and Insert a Gene
1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.
Gene Feature symbol: x-men synonyms: wolverine mRNA Feature exon_1: start: 12648 end: 13136 strand: 1 srcFeature_id: Id of genomic sample
Problem 1 - Create and Insert a Gene
1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.
Gene Feature symbol: xfile synonyms: mulder, scully description: A test gene for GMOD meeting mRNA Feature exon_1: start: 13691 end: 13767 strand: 1 srcFeature_id: Id of genomic sample exon_2: start: 14687 end: 14720 strand: 1 srcFeature_id: Id of genomic sample
Problem 1 - Create and Insert a Gene
symbol: xfile synonyms: mulder, scully description: A test gene for GMOD meeting …
<perl> my $gene_feature = new Modware::Feature(
-type => 'gene', -name => 'xfile', -description => 'A test gene for GMOD meeting', -source => 'GMOD 2007 Demo'
);
$gene_feature->add_synonym( 'mulder' ); $gene_feature->add_synonym( 'scully' );
- inserts object into database
$gene_feature->insert(); print 'Inserted gene with feature_id:'.$gene_feature->feature_id()."\n"; </perl>
Problem 1 - Create mRNA BioPerl Object
exon_1: start: 13691 end: 13767 strand: 1 srcFeature_id: Id of genomic sample exon_2: start: 14687 end: 14720 strand: 1 srcFeature_id: Id of genomic sample
<perl>
- First, create exon features (using Bioperl)
my $exon_1 = new Bio::SeqFeature::Gene::Exon (
-start => 13691, -end => 13767, -strand => 1, -is_coding => 1
);
my $exon_2 = new Bio::SeqFeature::Gene::Exon (
-start => 14687, -end => 14720, -strand => 1, -is_coding => 1
);
- Next, create transcript feature to 'hold' exons (using Bioperl)
my $bioperl_mrna = new Bio::SeqFeature::Gene::Transcript();
- Add exons to transcript (using Bioperl)
$bioperl_mrna->add_exon( $exon_1 ); $bioperl_mrna->add_exon( $exon_2 ); </perl>
Problem 1 - Create and Insert mRNA
The BioPerl object holds the location information, but now we want to create a Modware object and link it to the gene as well as locate it on the chromosome.
<perl>
# Now create Modware Feature to 'hold' bioperl object my $mrna_feature = new Modware::Feature( -type => 'mRNA', -bioperl => $bioperl_mrna, -source => 'GMOD 2007 Demo', -reference_feature => $reference_feature );
# Associate mRNA to gene (required for insertion) $mrna_feature->gene( $gene_feature );
# inserts object into database $mrna_feature->insert();
</perl>
Problem 2 - Writing the Report
2) Retrieve and print the following report for gene xfile
symbol: xfile synonyms: mulder, scully description: A test gene for GMOD meeting type: gene exon1 start: 13691 exon1 end: 13767 exon2 start: 14687 exon2 end: 14720 >xfile cds ATGGCGTTAGTATTCATGGTTACTGGTTTCGCTACTGATATCACCCAGCGTGTAGGCTGT GGAATCGAACACTGGTATTGTATAAATGTTTGTGAATACACTGAGAAATAA
Create new package, GMODWriter, to write the report, this package uses Modware and Bioperl methods.
<perl> use Modware::Gene; use GMODWriter;
my $xfile_gene = new Modware::Gene( -name => 'xfile' ); GMODWriter->Write_gene_report( $xfile_gene ); </perl>
- What's the difference between Modware::Gene and Modware::Feature? Gene is-a Feature.
Problem 2 - Writing the Report
2) Retrieve and print the following report for gene xfile
- The mRNA object contains the Bioperl object
- Why not just subclass? More flexibility the way shown here
<perl> package GMODWriter; sub Write_gene_report { my ($self, $gene) = @_; my $symbol = $gene->name();
my @synonyms = @{ $gene->synonyms() }; my $syn_string = join ",", @synonyms; my $description = $gene->description(); my $type = $gene->type();
- get features associated with the gene that are of type 'mRNA'
my ($mrna) = grep { $_->type() eq 'mRNA' } @{ $gene->features() };
- use bioperl method to get exons from mRNA
my @exons = $mrna->bioperl->exons_ordered();
- Modware will return a nice fasta file for you.
my $fasta = $mrna->sequence( -type => 'cds', -format => 'fasta' );
- Now print the actual report
print "symbol: $symbol\n"; print "synonyms: $syn_string\n"; print "description: $description\n"; print "type: $type\n";
my $count = 0; foreach my $exon (@exons ) {
$count++; print "exon${count} start: ".$exon->start()."\n";
print "exon${count} end: ".$exon->end()."\n";
} print "$fasta";
}
. . .
</perl>
Problem 3 - Updating a Gene Name
3) Update the gene xfile: change the name symbol to x-file and retrieve the changed record. Regenerate gene report
<perl>
use Modware::Gene; use Modware::DBH; use GMODWriter;
eval{
# get xfile gene my $xfile_gene = new Modware::Gene( -name => 'xfile' );
# change the name $xfile_gene->name( 'x-file' ); # write changes to database $xfile_gene->update();
# we can use the original object if we want, but instead # we refetch from the database to 'prove' the name has been changed my $xfile_gene2 = new Modware::Gene( -name => 'x-file' ); # use our GMODWriter package to write report for x-file GMODWriter->Write_gene_report( $xfile_gene2 );
}; if ($@){ warn $@; new Modware::DBH->rollback(); }
</perl>
Problem 4 - Search and Display Results
4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list (organism will vary):
1323 x-file Xenopus laevis 1324 x-men Xenopus laevis 1325 x-ray Xenopus laevis
<perl>
use Modware::Gene; use Modware::DBH; use GMODWriter;
# find genes starting with 'x-' my $results = Modware::Search::Gene->Search_by_name( 'x-*' );
# write the search results GMODWriter->Write_search_results( $results )
</perl>
Problem 4 - Search and Display Results
4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list (organism will vary):
1323 x-file Xenopus laevis 1324 x-men Xenopus laevis 1325 x-ray Xenopus laevis
<perl>
sub Write_search_results {
my ($self, $itr) = @_; # loop through iterator while (my $gene = $itr->next) { # print the requested information print $gene->feature_id . "\t" . $gene->name . "\t" . $gene->organism_name . "\n"; }
} </perl>
Problem 5 - Delete a Gene
5) Delete the gene x-ray. Run the search and report again.
1323 x-file Xenopus laevis 1324 x-men Xenopus laevis
<perl>
# get the xray gene my $xray = new Modware::Gene( -name => 'x-ray' );
- set is_deleted = 1, this will 'hide' the gene from searches,
- also sets the is_available to 0, the gene is no longer visible
- to a search.
$xray->is_deleted(1);
# write change to database $xray->update();
# find genes starting with 'x-' my $results = Modware::Search::Gene->Search_by_name( 'x-*' );
# write the search results GMODWriter->Write_search_results( $results )
</perl>
Other Modware Highlights
- Easy to write applications with Modware
- Extensible
- Available through Sourceforge
- Easy to install
- Large unit test coverage
- Current release 0.2-RC1
- Works with GMOD’s latest release
- Sample script demoed here are available
- sample_scripts directory
Other Nice Things About Modware
- Bioperl-style documentation
- http://gmod-ware.sourceforge.net/doc/
- POD for all methods
- If Chado changes then...
- Manually change Modware or ...
- AutoDBI will automatically adjust to the change, depends on the change
- Can set multiple connections through AutoDBI's
set_connection
Coming Attractions
- Support for changing genomic sequence
- ncRNAs
- UTRs
- Onotology modules
- Phenotype Annotations
- Getting a new database handle returns the existing
- Thinking about configuring modules to set what database handle can be used
- Pass an argument type to the Gene's feature() method
- Type the kind of synonym is being inserted?
- Possible: trade-off between simplicity and functionality
- Send us your ideas!
Discussion
- How hard is it to extend Modware?
- Not known absolutely, but generally thought to be not difficult
Acknowlegments
- Rex Chisholm, PhD
- Warren Kibbe, PhD
- Scott Cain
- Brian O’connor
- Sohel Merchant
- Petra Fey
- Pascale Gaudet,
- Karen Pilcher
- BioPerl
- GMOD
- SGD