Difference between revisions of "Modware Presentation"

   my $seq_io = new Bio::SeqIO(
      -file       => "../data/fake_chromosome.txt",
      -format => 'fasta'
   );
 
   # Bio::SeqIO will return a Bio::Seq object which
   # Modware uses as its representation
   my $seq = $seq_io->next_seq();
 
   my $reference_feature = new Modware::Feature(
      -type              => 'chromosome',
      -bioperl          => $seq,
      -description   => "This is a test",
      -name            => 'Fake',
      -source          => 'GMOD 2007 Demo'
   );
 
   # Inserts chromosome into database
   $reference_feature->insert();
</perl>
 
 
=====Problem 1 - Create and Insert a Gene=====
 
1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.
 
                         Gene Feature
                             symbol: x-ray
                             synonyms: none
                             mRNA Feature
                                 exon:
                                     start: 1703
                                     end: 1900
                                     strand: 1
                                     srcFeature_id: Id of genomic sample
 
=====Problem 1 - Create and Insert a Gene=====
 
1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.
 
                         Gene Feature
                            symbol: x-men
                            synonyms: wolverine
                            mRNA Feature
                                exon_1:
                                    start: 12648
                                    end: 13136
                                    strand: 1
                                    srcFeature_id:
                                        Id of genomic sample
 
=====Problem 1 - Create and Insert a Gene=====
 
1) Enter the information about the following three novel genes, including the   associated mRNA structures, into your database. Print the assigned feature_id   for each inserted gene.
 
                      Gene Feature
                          symbol: xfile
                          synonyms: mulder, scully
                          description: A test gene for GMOD meeting
                          mRNA Feature
                              exon_1:
                                  start: 13691
                                  end: 13767
                                  strand: 1
                                  srcFeature_id: Id of genomic sample
                              exon_2:
                                  start: 14687
                                  end: 14720
                                   strand: 1
                                   srcFeature_id: Id of genomic sample
 
=====Problem 1 - Create and Insert a Gene=====
 
       symbol: xfile
              synonyms: mulder, scully
              description: A test gene for GMOD meeting
      …
 
<syntaxhighlight lang="perl">
my $gene_feature = new Modware::Feature(
    -type             => 'gene',
    -name           => 'xfile',
    -description  => 'A test gene for GMOD meeting',
    -source         => 'GMOD 2007 Demo'
);
 
$gene_feature->add_synonym( 'mulder' );
$gene_feature->add_synonym( 'scully' );
 
# inserts object into database
$gene_feature->insert();
print 'Inserted gene with feature_id:'.$gene_feature->feature_id()."\n";
</perl>
 
=====Problem 1 - Create mRNA BioPerl Object=====
 
           exon_1:
           start: 13691
           end: 13767
           strand: 1
           srcFeature_id: Id of genomic sample
 
           exon_2:
           start: 14687
           end: 14720
           strand: 1
           srcFeature_id: Id of genomic sample
 
<syntaxhighlight lang="perl">
# First, create exon features (using Bioperl)
my $exon_1   = new Bio::SeqFeature::Gene::Exon (
   -start         => 13691,
   -end          => 13767,
   -strand      => 1,
   -is_coding => 1
);
 
my $exon_2   = new Bio::SeqFeature::Gene::Exon (
   -start         => 14687,
   -end          => 14720,
   -strand      => 1,
   -is_coding => 1
);
 
# Next, create transcript feature to 'hold' exons (using Bioperl)
my $bioperl_mrna = new Bio::SeqFeature::Gene::Transcript();
 
# Add exons to transcript (using Bioperl)
$bioperl_mrna->add_exon( $exon_1 );
$bioperl_mrna->add_exon( $exon_2 );
</perl>
 
=====Problem 1 - Create and Insert mRNA=====
 
The BioPerl object holds the location information, but now we want to create a Modware object and link it to the gene as well as locate it on the chromosome.
 
<syntaxhighlight lang="perl">
     # Now create Modware Feature to 'hold' bioperl object
     my $mrna_feature = new Modware::Feature(
         -type              => 'mRNA',
         -bioperl           => $bioperl_mrna,
         -source            => 'GMOD 2007 Demo',
         -reference_feature => $reference_feature
     );
 
     # Associate mRNA to gene (required for insertion)
     $mrna_feature->gene( $gene_feature );
 
    # inserts object into database
     $mrna_feature->insert();
</perl>
 
=====Problem 2 - Writing the Report=====
 
2) Retrieve and print the following report for gene xfile
 
    symbol: xfile
    synonyms: mulder, scully
    description: A test gene for GMOD meeting
    type: gene
    exon1 start: 13691
    exon1 end: 13767
    exon2 start: 14687
    exon2 end: 14720
    >xfile cds
    ATGGCGTTAGTATTCATGGTTACTGGTTTCGCTACTGATATCACCCAGCGTGTAGGCTGT
    GGAATCGAACACTGGTATTGTATAAATGTTTGTGAATACACTGAGAAATAA
 
Create new package, GMODWriter, to write the report, this package
uses Modware and Bioperl methods.
 
<syntaxhighlight lang="perl">
use Modware::Gene;
use GMODWriter;
 
my $xfile_gene = new Modware::Gene( -name => 'xfile' );
GMODWriter->Write_gene_report( $xfile_gene );
</perl>
 
* What's the difference between Modware::Gene and Modware::Feature? Gene is-a Feature.
 
=====Problem 2 - Writing the Report=====
 
2) Retrieve and print the following report for gene xfile
 
* The mRNA object contains the Bioperl object
** Why not just subclass? More flexibility the way shown here
 
<syntaxhighlight lang="perl">
package GMODWriter;
sub Write_gene_report {
my ($self, $gene)      = @_;
my $symbol = $gene->name();
 
my @synonyms = @{ $gene->synonyms() };
my $syn_string  = join ",", @synonyms;
my $description = $gene->description();
my $type        = $gene->type();
# get features associated with the gene that are of type 'mRNA'
my ($mrna)      = grep { $_->type() eq 'mRNA' } @{ $gene->features() };
# use bioperl method to get exons from mRNA
my @exons       = $mrna->bioperl->exons_ordered();
# Modware will return a nice fasta file for you.
my $fasta       = $mrna->sequence( -type => 'cds', -format => 'fasta' );
# Now print the actual report
print "symbol: $symbol\n";
print "synonyms: $syn_string\n";
print "description: $description\n";
print "type: $type\n";
 
my $count = 0;
foreach my $exon (@exons ) {
   $count++;
   print "exon${count} start: ".$exon->start()."\n";
 
   print "exon${count} end: ".$exon->end()."\n";
 
  }
  print "$fasta";
}
 . . .
</perl>
 
=====Problem 3 - Updating a Gene Name=====
 
3) Update the gene xfile: change the name symbol to x-file and retrieve the changed record. Regenerate gene report
 
<syntaxhighlight lang="perl">
 use Modware::Gene;
 use Modware::DBH;
 use GMODWriter;
 
 eval{
 
    # get xfile gene
    my $xfile_gene = new Modware::Gene( -name => 'xfile' );
 
    # change the name
    $xfile_gene->name( 'x-file' );
     # write changes to database
    $xfile_gene->update();
 
    # we can use the original object if we want, but instead
    # we refetch from the database to 'prove' the name has been changed
    my $xfile_gene2 = new Modware::Gene( -name => 'x-file' );
    # use our GMODWriter package to write report for x-file
    GMODWriter->Write_gene_report( $xfile_gene2 );
 
 };
 if ($@){
    warn $@;
    new Modware::DBH->rollback();
 }
</perl>
 
 
=====Problem 4 - Search and Display Results=====
 
4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list  (organism will vary):
 
    1323    x-file  Xenopus laevis
    1324    x-men   Xenopus laevis
    1325    x-ray   Xenopus laevis
 
<syntaxhighlight lang="perl">
     use Modware::Gene;
     use Modware::DBH;
     use GMODWriter;
 
     # find genes starting with 'x-'
     my $results = Modware::Search::Gene->Search_by_name( 'x-*' );
 
     # write the search results
     GMODWriter->Write_search_results( $results )
</perl>
 
 
=====Problem 4 - Search and Display Results=====
 
4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list  (organism will vary):
 
    1323    x-file  Xenopus laevis
    1324    x-men   Xenopus laevis
    1325    x-ray   Xenopus laevis
 
 
<syntaxhighlight lang="perl">
sub Write_search_results {
  my ($self, $itr) = @_;
  # loop through iterator
  while (my $gene = $itr->next) {
    # print the requested information
    print $gene->feature_id . "\t" . $gene->name .
      "\t" . $gene->organism_name . "\n";
  }
}
</perl>
 
=====Problem 5 - Delete a Gene=====
 
5) Delete the gene x-ray. Run the search and report again.
 
    1323    x-file  Xenopus laevis
    1324    x-men   Xenopus laevis
 
<syntaxhighlight lang="perl">
 # get the xray gene
 my $xray = new Modware::Gene( -name => 'x-ray' );
 
# set is_deleted = 1, this will 'hide' the gene from searches,
# also sets the is_available to 0, the gene is no longer visible
# to a search.
 
 $xray->is_deleted(1);
 
 # write change to database
 $xray->update();
 
 # find genes starting with 'x-'
 my $results = Modware::Search::Gene->Search_by_name( 'x-*' );
 
 # write the search results
 GMODWriter->Write_search_results( $results )
</perl>
 
 
=====Other Modware Highlights=====
 
* Easy to write applications with Modware
* Extensible
* Available through Sourceforge
** http://gmod-ware.sourceforge.net
* Easy to install
* Large unit test coverage
* Current release 0.2-RC1
** Works with GMOD’s latest release
* Sample script demoed here are available
** sample_scripts directory
 
=====Other Nice Things About Modware=====
 
 
* Bioperl-style documentation
** http://gmod-ware.sourceforge.net/doc/
** POD for all methods
* If [[Chado]] changes then...
** Manually change [[Modware]] or ...
** [[Chado::AutoDBI]] will automatically adjust to the change, depends on the change
* Can set multiple connections through AutoDBI's <code>set_connection</code>
 
=====Coming Attractions=====
 
* Support for changing genomic sequence
* ncRNAs
* UTRs
* Onotology modules
* Phenotype Annotations
* Getting a new database handle returns the existing
** Thinking about configuring modules to set what database handle can be used
* Pass an argument ''type'' to the Gene's feature() method
* Type the kind of synonym is being inserted?
** Possible: trade-off between simplicity and functionality
 
* Send us your ideas!
 
 
=====Discussion=====
 
* How hard is it to extend Modware?
** Not known absolutely, but generally  thought to be not difficult
 
=====Acknowlegments=====
 
* Rex Chisholm, PhD
* Warren Kibbe, PhD
* [[User:Scott|Scott Cain]]
* Brian O’connor
* Sohel Merchant
* Petra Fey
* Pascale Gaudet,
* Karen Pilcher
 
* [[BioPerl]]
* GMOD
* [[:Category:SGD|SGD]]
 
[[Category:Modware]]
[[Category:BioPerl]]