|
|
| Line 1: |
Line 1: |
| − | This tutorial on [[GBrowse syn]] was taught by [[User:Mckays|Sheldon McKay]] as part of the [[2013 GMOD Summer School]].
| + | #REDIRECT [[GBrowse_syn_Tutorial]] |
| − | | + | |
| − | The starting image for this tutorial is '''2013 GMOD start day 4 (ami-3f7c0456)'''. It can be run as a micro or small instance.
| + | |
| − | | + | |
| − | * If you are not using the Amazon EC2 instance, the system paths may vary from those described below.
| + | |
| − | | + | |
| − |
| + | |
| − | | + | |
| − | [[GBrowse_syn|GBrowse_syn]] is a [[GBrowse|GBrowse]]-based [[Synteny|synteny]] browser designed to display multiple genomes, with a central reference species compared to two or more additional species. It is included with the standard GBrowse package (version 1.69 and later).
| + | |
| − | | + | |
| − | [[File:Gbrowse_syn.png|thumb|none|600px|GBrowse_syn at The Arabidopsis Information Resource (TAIR)]]
| + | |
| − | | + | |
| − | Working examples of GBrowse_syn can be seen at [http://www.arabidopsis.org/cgi-bin/gbrowse_syn/arabidopsis/?name=Chr1%3A8367000..8370501;search_src=thaliana TAIR] and [http://mckay.cshl.edu/seq/gbrowse_syn/compara?search_src=Cele;name=X:1050001..1150000 WormBase].
| + | |
| − | | + | |
| − | | + | |
| − | ==GBrowse_syn Introduction==
| + | |
| − | | + | |
| − | [[Media:Gbrowse_syn_Intro-2013-Summer-School.pptx|Introductory talk on GBrowse_syn]]
| + | |
| − | | + | |
| − | ==Installing GBrowse_syn==
| + | |
| − | | + | |
| − | GBrowse_syn is part of the GBrowse 2.0 package and was pre-installed when you went through the [[GBrowse 2.0 HOWTO|GBrowse 2.0 installation]].
| + | |
| − | | + | |
| − | Update GBrowse to get recent changes
| + | |
| − | '''1) Get a copy of the Gbrowse github repository
| + | |
| − | $ <span class=enter>git clone https://github.com/GMOD/GBrowse.git GBrowse</span>
| + | |
| − | | + | |
| − | '''2) Clean up the synteny conf folder (the may be some older junk lying around)'''
| + | |
| − | $ <span class=enter>sudo rm -f /data/etc/gbrowse2/synteny/*</span>
| + | |
| − |
| + | |
| − | '''3) Upgrade GBrowse'''
| + | |
| − | <div class=emphasisbox><b>
| + | |
| − | * Select /data/etc/gbrowse2/ when prompted (instead of /etc/gbrowse2)
| + | |
| − | * Select <span class=tt>K (Keep)</span> when prompted if you do not want to overwrite default configuration files
| + | |
| − | </b></div>
| + | |
| − | $ <span class=enter>cd ~/GBrowse</span>
| + | |
| − | $ <span class=enter>perl Build.PL</span>
| + | |
| − | $ <span class=enter>perl Build install</span>
| + | |
| − | | + | |
| − | '''4) Create a symbolic link to the GBrowse temp folder (for caching of sessions, images, etc)'''
| + | |
| − | $ <span class=enter>cd /var/www</span>
| + | |
| − | $ <span class=enter>ln -s ../tmp</span>
| + | |
| − | | + | |
| − | ==Running GBrowse for the First Time==
| + | |
| − | | + | |
| − | Point your browser to <nowiki>http://</nowiki>{{Template:AWSurl}}/cgi-bin/gb2/gbrowse_syn
| + | |
| − | | + | |
| − | [[Image:GBrowse_synWelcome.png|thumb|none|600px|Welcome screen]]
| + | |
| − | | + | |
| − | This is the welcome screen you should see after installing a new copy of GBrowse_syn with no configured data sources. It contains instructions on how to set up the example data source provided with the distribution.
| + | |
| − | | + | |
| − | ==Setting up the sample data==
| + | |
| − | | + | |
| − | <div class="emphasisbox">
| + | |
| − | * Sample data and configuration information for GBrowse_syn come pre-packaged with GBrowse.
| + | |
| − | * The example we will use is a two-species comparison of rice (''Oryza sativa'') and one of its wild relatives*
| + | |
| − | | + | |
| − | <div class="zero small">*Data courtesy of Bonnie Hurwitz</div>
| + | |
| − | </div>
| + | |
| − | | + | |
| − | ===Setting up the Alignment Database===
| + | |
| − | | + | |
| − | The alignment, or joining database will contain the sequence alignments between the two rice species. It will be in a [[MySQL|MySQL]] database.
| + | |
| − | If mysql is not installed on your server, you can install it as follows:
| + | |
| − | | + | |
| − | '''Debian-based Linux distributions:'''
| + | |
| − | $ sudo apt-get update
| + | |
| − | $ sudo apt-get install mysql-client
| + | |
| − | $ sudo apt-get install mysql-server
| + | |
| − | | + | |
| − | '''RedHat-based Linux distributions'''
| + | |
| − | $ sudo yum install mysql
| + | |
| − | <div class="emphasisbox">
| + | |
| − | Note: You set the mysql root password at the time of installation. Use 'gbsyndemo' or else be sure to remember the password for use later.
| + | |
| − | </div>
| + | |
| − | '''1) Create a MySQL database to hold the alignment data'''
| + | |
| − | | + | |
| − | $ <span class="enter">mysql -u root -p</span>
| + | |
| − | Enter password: <span class="enter">****************</span>
| + | |
| − | <pre>
| + | |
| − | Welcome to the MySQL monitor. Commands end with ; or \g.
| + | |
| − | Your MySQL connection id is 37
| + | |
| − | Server version: 5.1.37-1ubuntu5.1 (Ubuntu)
| + | |
| − | | + | |
| − | Type 'help;' or '\h' for help. Type '\c' to clear the current input statement.
| + | |
| − | | + | |
| − | mysql> create database rice_synteny;
| + | |
| − | Query OK, 1 row affected (0.00 sec)
| + | |
| − | | + | |
| − | mysql>
| + | |
| − | </pre>
| + | |
| − | | + | |
| − | '''2) Give read-only (SELECT privileges in SQL) to the default apache user <tt>www-data</tt>.'''
| + | |
| − | We can do this for all of the MySQL databases, since they are all for web applications
| + | |
| − | | + | |
| − | mysql> <span class="enter">GRANT SELECT on *.* TO 'www-data'@'localhost';</span>
| + | |
| − | Query OK, 0 rows affected (0.00 sec)
| + | |
| − | | + | |
| − | mysql> <span class="enter">quit</span>
| + | |
| − | | + | |
| − | '''3) Load the sample alignment database. You need to have root-level access (be a sudoer) for some of the steps below.'''
| + | |
| − | | + | |
| − | $ <span class="enter">cd /data/var/lib/gbrowse2/databases/gbrowse_syn/alignments</span>
| + | |
| − | | + | |
| − | Have a look at the first few lines of the data:
| + | |
| − | | + | |
| − | $ <span class="enter">zcat rice.aln.gz | head -20</span>
| + | |
| − | <pre>
| + | |
| − | CLUSTAL W(1.81) multiple sequence alignment W(1.81)
| + | |
| − | | + | |
| − | | + | |
| − | rice-3(+)/16598648-16600199 ggaggccggccgtctgccatgcgtgagccagacggggcgggccggagacaggccacgtgg
| + | |
| − | wild_rice-3(+)/14467855-14469373 gggggccgg------------------------------------agacaggccacgtgg
| + | |
| − | ** ****** ***************
| + | |
| − | | + | |
| − | | + | |
| − | rice-3(+)/16598648-16600199 ccctgccccgggctgttgacccactggcacccctgtcccgggttgtcgccctcctttccc
| + | |
| − | wild_rice-3(+)/14467855-14469373 ccctgccccgggctgttgacccactggcacccctgtcccgggttgtcgccctcctttccc
| + | |
| − | ************************************************************
| + | |
| − | | + | |
| − | | + | |
| − | rice-3(+)/16598648-16600199 cgccatgctctaagtttgctcctcttctcgaacttctctctttgattcttcacgtcctct
| + | |
| − | wild_rice-3(+)/14467855-14469373 cgccatgctctaagtttgctcctcttctcgaacttctctctttgattcttcacgtcctct
| + | |
| − | ************************************************************
| + | |
| − | | + | |
| − | | + | |
| − | rice-3(+)/16598648-16600199 tggagcctccccttctagctcgatcacgctctgctcttccgcttggaggctggcaaaact
| + | |
| − | wild_rice-3(+)/14467855-14469373 tggagcctccccttctagctcgatcgcgctctgctcttccgcttggaggctggcaaaact
| + | |
| − | </pre>
| + | |
| − | | + | |
| − | The format is CLUSTALW. This is a formatting convention; it does not mean CLUSTALW was used to generate the alignment data. See [[#Further Reading|Further Reading]] below for more information on data loading and the meta-data in the sequence names
| + | |
| − | | + | |
| − | Load the database with the script <tt>gbrowse_syn_load_alignments_msa.pl</tt>, which is automatically installed along with GBrowse. See the [GBrowse_syn scripts] page for details on the options for the script.
| + | |
| − | | + | |
| − | $ <span class="enter">zcat rice.aln.gz | gbrowse_syn_load_alignments_msa.pl -u root -p ******* -d rice_synteny -c -v -</span>
| + | |
| − | | + | |
| − | There are 185 alignment blocks, it takes a moment to load
| + | |
| − | | + | |
| − | ===Setting up the Configuration Files===
| + | |
| − | <div class="emphasisbox">
| + | |
| − | * The configuration files required for this data source are pre-installed with [[GBrowse]], in <tt>/data/etc/gbrowse2/synteny/</tt>.
| + | |
| − | * There are config files for two species, <tt>rice_synteny.conf</tt> and <tt>wild_rice_synteny.conf</tt>, and the joining config file, <tt>oryza.synconf</tt>. The latter file has been disabled by appending a '.disabled' extension to the file name.
| + | |
| − | </div>
| + | |
| − | | + | |
| − | The joining config file, <tt>oryza.synconf</tt>:
| + | |
| − | <pre>
| + | |
| − | [GENERAL]
| + | |
| − | description = BLASTZ alignments for Oryza sativa
| + | |
| − | | + | |
| − | ====Sample Configuration Files====
| + | |
| − | # The synteny database
| + | |
| − | join = dbi:mysql:database=rice_synteny;host=localhost
| + | |
| − | | + | |
| − | # This option maps the relationship between the species data sources, names and descriptions
| + | |
| − | # The value for "name" (the first column) is the symbolic name that gbrowse_syn users to identify each species.
| + | |
| − | # This value is also used in two other places in the gbrowse_syn configuration:
| + | |
| − | # the species name in the "examples" directive and the species name in the .aln file
| + | |
| − | # The value for "conf. file" is the basename of the corresponding gbrowse .conf files.
| + | |
| − | # This value is also used to identify the species configuration stanzas at the bottom of the configuration file.
| + | |
| − | | + | |
| − | # name conf. file Description
| + | |
| − | source_map = rice rice_synteny "Domesic Rice (O. sativa)"
| + | |
| − | wild_rice wild_rice_synteny "Wild Rice"
| + | |
| − | | + | |
| − | tmpimages = /tmp/gbrowse2
| + | |
| − | imagewidth = 800
| + | |
| − | stylesheet = /gbrowse2/css/gbrowse_transparent.css
| + | |
| − | cache time = 1
| + | |
| − | | + | |
| − | config_extension = conf
| + | |
| − | | + | |
| − | # example searches to display
| + | |
| − | examples = rice 3:16050173..16064974
| + | |
| − | wild_rice 3:1..400000
| + | |
| − | | + | |
| − | zoom levels = 5000 10000 25000 50000 100000 200000 400000
| + | |
| − | | + | |
| − | # species-specific databases
| + | |
| − | [rice_synteny]
| + | |
| − | tracks = EG
| + | |
| − | color = blue
| + | |
| − | | + | |
| − | [wild_rice_synteny]
| + | |
| − | tracks = EG
| + | |
| − | color = red
| + | |
| − | </pre>
| + | |
| − | | + | |
| − | A sample species config file, <tt>rice_synteny.conf</tt>:
| + | |
| − | <pre>
| + | |
| − | [GENERAL]
| + | |
| − | description = Domestic rice chromosome 3
| + | |
| − | db_adaptor = Bio::DB::SeqFeature::Store
| + | |
| − | db_args = -adaptor memory
| + | |
| − | -dir /var/www/gbrowse2/databases/gbrowse_syn/rice
| + | |
| − | | + | |
| − | | + | |
| − | # Web site configuration info
| + | |
| − | tmpimages = /tmp/gbrowse2
| + | |
| − | | + | |
| − | [EG]
| + | |
| − | feature = gene:ensembl
| + | |
| − | glyph = gene
| + | |
| − | height = 10
| + | |
| − | bgcolor = peachpuff
| + | |
| − | fgcolor = hotpink
| + | |
| − | description = 0
| + | |
| − | label = 0
| + | |
| − | category = Transcripts
| + | |
| − | key = ensembl gene
| + | |
| − | balloon hover = Hello, my name is $name!
| + | |
| − | | + | |
| − | </pre>
| + | |
| − | <div class="emphasisbox">
| + | |
| − | Note: the species databases are actually using the [[GFF3]] flat file, in-memory adapter
| + | |
| − | </div>
| + | |
| − | | + | |
| − | ====Activating the Oryza Data Source====
| + | |
| − | | + | |
| − | '''1) Make sure the temporary image directory specified in the config files exists and is world-writable'''
| + | |
| − | | + | |
| − | $ <span class="enter">sudo mkdir /var/www/tmp</span>
| + | |
| − | $ <span class="enter">sudo mkdir /var/www/tmp/gbrowse2</span>
| + | |
| − | $ <span class="enter">sudo chmod 777 /var/www/tmp/gbrowse2</span>
| + | |
| − | | + | |
| − | 2) Renaming the configuration file
| + | |
| − | | + | |
| − | $ <span class="enter">cd /data/etc/gbrowse2/synteny</span>
| + | |
| − | $ <span class="enter">sudo mv oryza.synconf.disabled.conf oryza.synconf</span>
| + | |
| − | | + | |
| − | '''3) Point your browser to <nowiki>http://</nowiki>{{Template:AWSurl}}/cgi-bin/gb2/gbrowse_syn/oryza (or your own URL if you are not using the Amazon EC2 instance). You should see''':
| + | |
| − | | + | |
| − | [[Image:GBrowse_synWe_made_it1.png|thumb|none|800px]]
| + | |
| − | | + | |
| − | '''4) Click on the first example, you should (eventually) see:'''
| + | |
| − | | + | |
| − | [[Image:GBrowse_synWe_made_it2.png|thumb|none|800px]]
| + | |
| − | | + | |
| − | '''5) Try out a few user interface features:'''
| + | |
| − | | + | |
| − | * mouse over one of the genes:
| + | |
| − | [[File:Gbrowse_synBubble1.png]]
| + | |
| − | * Click on one of the bold blue highlighted section titles. This takes you to a contextual help page on the GMOD wiki.
| + | |
| − | <!--* Click and drag on the overview panel. This will trigger rubber band selection to recenter or resize the displayed image-->
| + | |
| − | | + | |
| − | ===Speeding up the Browser===
| + | |
| − | | + | |
| − | You can speed up the image loading time by putting your species' [[GFF3]] data into relational MySQL databases.
| + | |
| − | | + | |
| − | '''1) Create a database for each of the GFF data files (<tt>rice.gff3</tt> and <tt>wild_rice.gff3</tt>).'''
| + | |
| − | | + | |
| − | $ <span class="enter">mysql -uroot -pgbsyndemo</span>
| + | |
| − | | + | |
| − | mysql> <span class="enter">create database rice;</span>
| + | |
| − | Query OK, 1 row affected (0.00 sec)
| + | |
| − | | + | |
| − | mysql> <span class="enter">create database wild_rice;</span>
| + | |
| − | Query OK, 1 row affected (0.00 sec)
| + | |
| − | | + | |
| − | mysql> <span class="enter">quit</span>
| + | |
| − | | + | |
| − | '''2) Populate the databases using the [[GBrowse Install HOWTO#GFF3|Loading <tt>bp_seqfeature_load</tt>]] (pre-installed as part of [[BioPerl|BioPerl]] with [[GBrowse]]).'''
| + | |
| − | This will load the [[GFF3]] data into a MySQL relational database. Note the MySQL user will root-level privileges.
| + | |
| − | | + | |
| − | $ <span class="enter">cd /var/www/gbrowse2/databases/gbrowse_syn/rice</span>
| + | |
| − | $ <span class="enter">bp_seqfeature_load -u root -p gbsyndemo -d rice -c -f rice.gff3</span>
| + | |
| − | loading rice.gff3...
| + | |
| − | Building object tree...
| + | |
| − | 0.55s0s
| + | |
| − | | + | |
| − | Loading bulk data into database... 0.73s
| + | |
| − | load time: 11.99s
| + | |
| − | | + | |
| − | $ <span class="enter">cd ../wild_rice</span>
| + | |
| − | $ <span class="enter">bp_seqfeature_load -u root -p gbsyndemo -d wild_rice -c -f wild_rice.gff3</span>
| + | |
| − | loading wild_rice.gff3...
| + | |
| − | Building object tree...
| + | |
| − | 0.55s7a
| + | |
| − | | + | |
| − | Loading bulk data into database... 0.69s
| + | |
| − | load time: 12.02s
| + | |
| − | | + | |
| − | '''3) Modify the following stanza in the file <tt>rice_synteny.conf</tt> in cd /etc/gbrowse2/synteny/.'''
| + | |
| − | This will convert your data source from a flat file database to a MySQL relational database.
| + | |
| − | | + | |
| − | # from
| + | |
| − | db_args = -adaptor memory
| + | |
| − | -dir /var/www/html/gbrowse/databases/gbrowse_syn/rice
| + | |
| − | | + | |
| − | # to
| + | |
| − | db_args = -adaptor DBI::mysql
| + | |
| − | -dsn dbi:mysql:rice
| + | |
| − | | + | |
| − | '''4) repeat for <tt>wild_rice_synteny.conf</tt>'''
| + | |
| − | | + | |
| − | ==Using Non-alignment Data==
| + | |
| − | | + | |
| − | <div class="emphasisbox">
| + | |
| − | This example uses gene orthology-based synteny blocks* based created by [http://genome.sfu.ca/orthoclusterdb OrthoCluster] for three nematode species, <i>C. elegans</i>, <i>C. briggsae</i> and <i>P. pacificus</i>.
| + | |
| − | <div class="zero small">''*Data courtesy of Jack Chen and Ismael Vergera''</div>
| + | |
| − | </div>
| + | |
| − | | + | |
| − | '''1) Download and unpack the data archive file <tt>orthocluster.tar.gz</tt>'''.
| + | |
| − | | + | |
| − | $ <span class="enter">mkdir ~/data</span>
| + | |
| − | $ <span class="enter">cd data</span>
| + | |
| − | $ <span class="enter">wget http://gmod.org/extras/orthocluster.tar.gz</span>
| + | |
| − | $ <span class="enter">tar zxvf orthocluster.tar.gz</span>
| + | |
| − | ORTHOCLUSTER/
| + | |
| − | ORTHOCLUSTER/conf/
| + | |
| − | ORTHOCLUSTER/gff/
| + | |
| − | ORTHOCLUSTER/orthocluster.txt
| + | |
| − | ORTHOCLUSTER/gff/bri.gff3
| + | |
| − | ORTHOCLUSTER/gff/ele.gff3
| + | |
| − | ORTHOCLUSTER/gff/ppa.gff3
| + | |
| − | ORTHOCLUSTER/conf/bri.conf
| + | |
| − | ORTHOCLUSTER/conf/ele.conf
| + | |
| − | ORTHOCLUSTER/conf/orthocluster.synconf
| + | |
| − | ORTHOCLUSTER/conf/ppa.conf
| + | |
| − | | + | |
| − | ===Species Gene Annotations===
| + | |
| − | In the <tt>gff</tt> directory, there are GFF3 annotations for three species
| + | |
| − | | + | |
| − | <span class=enter> $ head -20 ele.gff3</span>
| + | |
| − | ##gff-version 3
| + | |
| − | ##sequence-region I 1 15072421
| + | |
| − | ##sequence-region II 1 15279324
| + | |
| − | ##sequence-region III 1 13783685
| + | |
| − | ##sequence-region IV 1 17493784
| + | |
| − | ##sequence-region V 1 20924143
| + | |
| − | ##sequence-region X 1 17718854
| + | |
| − | IV curated mRNA 11012483 11015853 . - . ID=F13H10.3a;Name=F13H10.3a
| + | |
| − | IV curated CDS 11012483 11012648 . - 1 Parent=F13H10.3a
| + | |
| − | IV curated CDS 11012694 11012932 . - 0 Parent=F13H10.3a
| + | |
| − | IV curated CDS 11013456 11013667 . - 2 Parent=F13H10.3a
| + | |
| − | IV curated CDS 11013719 11013817 . - 2 Parent=F13H10.3a
| + | |
| − | IV curated CDS 11013878 11014105 . - 2 Parent=F13H10.3a
| + | |
| − | IV curated CDS 11014195 11014434 . - 2 Parent=F13H10.3a
| + | |
| − | IV curated CDS 11014489 11014646 . - 1 Parent=F13H10.3a
| + | |
| − | IV curated CDS 11014695 11014792 . - 0 Parent=F13H10.3a
| + | |
| − | IV curated CDS 11014841 11015114 . - 1 Parent=F13H10.3a
| + | |
| − | IV curated CDS 11015624 11015724 . - 0 Parent=F13H10.3a
| + | |
| − | IV curated CDS 11015821 11015853 . - 0 Parent=F13H10.3a
| + | |
| − | II curated mRNA 2824413 2824910 . + . ID=K12H6.9;Name=K12H6.9
| + | |
| − | | + | |
| − | '''2) Create a new data for ''C. elegans'''''
| + | |
| − | | + | |
| − | $ <span class=enter>mysql -uroot -pgbsyndemo -e 'create database ele'</span>
| + | |
| − | | + | |
| − | '''3) Create and load a Bio::DB:SeqFeature::Store database for ''C. elegans'' (ele).'''
| + | |
| − | | + | |
| − | We use screen so that we can get the time-consuming loading script started and then use <tt>Ctrl-A D</tt> to set the screen running in the background' and move on to other steps.
| + | |
| − | | + | |
| − | $ <span class=enter>screen bp_seqfeature_load -u root -p gbsyndemo -d ele -c -f ele.gff3</span>
| + | |
| − | | + | |
| − | '''4) Repeat steps 2 and 3 for the other two species (bri and ppa).'''
| + | |
| − | | + | |
| − | ===Configurations Files===
| + | |
| − | The <span class=tt>conf</span> has configuration files for each of the species and the alignment database.
| + | |
| − |
| + | |
| − | '''Example species configuration:'''
| + | |
| − | <pre>
| + | |
| − | [GENERAL]
| + | |
| − | description = C. briggsae
| + | |
| − | db_adaptor = Bio::DB::SeqFeature::Store
| + | |
| − | db_args = -dsn dbi:mysql:bri
| + | |
| − | | + | |
| − | tmpimages = /tmp/gbrowse2
| + | |
| − | | + | |
| − | [CG]
| + | |
| − | label = 1
| + | |
| − | description = 1
| + | |
| − | feature = mRNA
| + | |
| − | category = Genes
| + | |
| − | glyph = processed_transcript
| + | |
| − | font2color = blue
| + | |
| − | height = 6
| + | |
| − | key = Gene Models
| + | |
| − | bgcolor = sub {
| + | |
| − | my $flip = pop->panel->flip;
| + | |
| − | my $strand = shift->strand;
| + | |
| − | return $strand < 0 ? 'violet' : 'turquoise' if $flip;
| + | |
| − | return $strand > 0 ? 'violet' : 'turquoise';
| + | |
| − | }
| + | |
| − | | + | |
| − | # draw genes differently for segments > 100Kb
| + | |
| − | [CG:100001]
| + | |
| − | label = 0
| + | |
| − | description = 0
| + | |
| − | glyph = generic
| + | |
| − | strand_arrow = 1
| + | |
| − | </pre>
| + | |
| − | | + | |
| − | '''The alignment configuration:'''
| + | |
| − | <pre>
| + | |
| − | [GENERAL]
| + | |
| − | description = OrthoCluster Perfect Synteny Blocks
| + | |
| − | | + | |
| − | # The synteny database
| + | |
| − | join = dbi:mysql:orthocluster
| + | |
| − | | + | |
| − | # symbolic src config file (".conf") Description
| + | |
| − | source_map = ele ele "C. elegans"
| + | |
| − | bri bri "C. briggsae"
| + | |
| − | ppa ppa "P. pacificus"
| + | |
| − | | + | |
| − | | + | |
| − | # web site configuration info
| + | |
| − | tmpimages = /tmp/gbrowse2
| + | |
| − | imagewidth = 800
| + | |
| − | stylesheet = /gbrowse2/css/gbrowse_transparent.css
| + | |
| − | | + | |
| − | | + | |
| − | # The extension of species config files
| + | |
| − | # can also use .syn (the default)
| + | |
| − | config_extension = conf
| + | |
| − | | + | |
| − | # sparse data, use all coordinates
| + | |
| − | grid coordinates = exact
| + | |
| − | | + | |
| − | # example searches to display
| + | |
| − | examples = ele X:402000..426999
| + | |
| − | bri chrX:255000..275000
| + | |
| − | | + | |
| − | zoom levels = 5000 10000 25000 50000 100000 200000 400000 1000000
| + | |
| − | | + | |
| − | # species-specific databases
| + | |
| − | [ele]
| + | |
| − | tracks = CG
| + | |
| − | color = green
| + | |
| − | | + | |
| − | [bri]
| + | |
| − | tracks = CG
| + | |
| − | color = blue
| + | |
| − | | + | |
| − | [ppa]
| + | |
| − | tracks = CG
| + | |
| − | color = red
| + | |
| − | </pre>
| + | |
| − | | + | |
| − | '''5) Install the configuration files'''
| + | |
| − | $ cd ~/data/ORTHOCLUSTER/conf
| + | |
| − | $ sudo cp *.conf /data/etc/gbrowse2/synteny
| + | |
| − |
| + | |
| − | ===The Alignment Data===
| + | |
| − | The file <tt>orthocluster.txt</tt> contains the synteny data. The first few lines are shown below. The first 12 fields in each row specify information about the synteny block in each species and the series of numbers are orthologous gene coordinate pairs that are used for linking orthologs with grid-lines in the GBrowse_syn display. See 'Alignment Data' under [[#Further Reading|Further Reading]] below for more details of this loading format.
| + | |
| − | <pre>
| + | |
| − | bri chrI 176154 183558 + . ppa Ppa_Contig88 27212 30786 + . 176154 27212 177594 30786 182118 27212 183558 30786 | 30786 183558 27212 182118 30786 177594 27212 176154
| + | |
| − | bri chrI 778780 799223 + . ppa Ppa_Contig88 533454 542961 - . 778780 539924 786778 542961 789497 533454 799223 538726 | 538726 799223 533454 789497 542961 786778 539924 778780
| + | |
| − | bri chrI 986150 994698 + . ppa Ppa_Contig77 29481 45600 - . 986150 37055 989649 45600 991428 29481 994698 36608 | 36608 994698 29481 991428 45600 989649 37055 986150
| + | |
| − | bri chrI 1453793 1461931 + . ppa Ppa_Contig132 156183 165414 - . 1453793 163110 1456404 165414 1456712 160849 1457637 162712 1458361 160204 1459245 160815 1459468 159346 1459854 160000 1459962 156183 1461931 159022 | 159022 1461931 156183 1459962 160000 1459854 159346 1459468 160815 1459245 160204 1458361 162712 1457637 160849 1456712 165414 1456404 163110 1453793
| + | |
| − | </pre>
| + | |
| − | | + | |
| − | '''6) Create and load the alignment the alignment database. The <tt>gbrowse_syn_load_alignment_database.pl</tt> script is pre-installed with [[GBrowse]].'''
| + | |
| − | | + | |
| − | $ <span class="enter">cd ..</span>
| + | |
| − | $ <span class="enter">mysql -uroot -pgbsyndemo -e 'create database orthocluster'</span>
| + | |
| − | $ <span class="enter">gbrowse_syn_load_alignment_database.pl -u root -p gbsyndemo -d orthocluster -c -v orthocluster.txt</span>
| + | |
| − | | + | |
| − | '''7) Go back to your browser and reload the rice page. There should now be a second data source in a pull-down menu.'''
| + | |
| − | | + | |
| − | [[File:GBrowse_synPulldown1.png]]
| + | |
| − | | + | |
| − | '''8) Select the other data source and start browsing!'''
| + | |
| − | | + | |
| − | [[File:Gbrowse_synEtfinit.png|thumb|none|700px]]
| + | |
| − | | + | |
| − | ==Further Reading==
| + | |
| − | ===A Note on Whole Genome Alignments===
| + | |
| − | The focus of the section of the course is on dealing with alignment or synteny data and using [[GBrowse_syn]]. However, how to generate whole genome alignments, identify orthologous regions, etc., are the subject of considerable interest, so some background reading is listed below:
| + | |
| − | *[http://www.eecs.berkeley.edu/Pubs/TechRpts/2006/EECS-2006-104.html Primer on Hierarchical Genome Alignment Strategies]
| + | |
| − | *[http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2577869 article on PECAN and ENREDO]
| + | |
| − | *[http://www.ebi.ac.uk/~bjp/pecan/ all about PECAN]
| + | |
| − | * The gene annotations for each species are in [[GFF]] files.
| + | |
| − | * The alignment data are in a [[GBrowse_syn Database#Clustal alignment format|constrained CLUSTALW format]] (They were not generated by the program CLUSTALW, which is not necessarily suitable for whole genome alignments)
| + | |
| − | * There are processing steps for the alignment data but it is very computationally intensive and we will load pre-processed data to get a head start.
| + | |
| − | | + | |
| − | ===Documentation===
| + | |
| − | There is detailed documentation on the GMOD wiki for how to install, configure and use GBrowse_syn. To get started, browse these pages:
| + | |
| − | *[[GBrowse_syn|GBrowse_syn overview]]
| + | |
| − | *[[GBrowse_syn#Installation|Installation]]
| + | |
| − | *[[GBrowse_syn Configuration|Configuration]]
| + | |
| − | *[[GBrowse_syn Database|Alignment Data]]
| + | |
| − | *[[GBrowse_syn Help|The user interface]]
| + | |
| − | *[[GBrowse_syn#Presentations_and_Workshops|Presentations and workshops]]
| + | |
