GBrowse syn Database

GBrowse_syn is a GBrowse based synteny viewer. This page describes the database that GBrowse_syn uses, and how to get syntenic data into that database.

Schema

• The alignment database schema is very simple; it has a tables for all reciprocal 'hits', or alignment features and a table for (optional) 1:1 coordinate maps
• The alignments table contains coordinate information and also support cigar-line representations and the alignment to facilitate future reconstruction of the alignment within GBrowse_syn.

Sample data

• Sample data and configuration files can be downloaded from the GMOD FTP site.
• These data are for two rice species (courtesy of Bonnie Hurwitz)

Loading

Input formats for alignment, colinearity or synteny data

• The starting point for loading the alignment database is typically a multiple sequence alignment file
• The source of the alignment data is up to you but the supported aligment inputs formats for entry are currently CLUSTALW, FASTA, SELEX, MSF and STOCKHOLM. Which format is not particularly important, as long as is is recognized by the Bio::SeqIO library for parsing and allows sequence names long enough to accommodate the rules below.

NOTE: It is necessary to overload the sequence IDs with meta-data about the alignment, using naming convention "species-seqid(strand)/start-end" shown in the example below

Example Alignment Data

selex format

rice-3(+)/16598648-16598707         ggaggccggccgtctgccatgcgtgagccagacggggcgggccggagacaggccacgtgg
wild_rice-3(+)/14467855-14467878    gggggccgg------------------------------------agacaggccacgtgg

MSF format

NoName   MSF: 2  Type: N  Thu Aug  6 10:56:43 2009  Check: 00 ..

 Name: rice-3(+)/16598648-16598707       Len:    60  Check:  4764  Weight:  1.00
 Name: wild_rice-3(+)/14467855-14467878  Len:    60  Check:  932  Weight:  1.00

//


                                  1                                                   50
rice-3(+)/16598648-16598707       ggaggccggc cgtctgccat gcgtgagcca gacggggcgg gccggagaca
wild_rice-3(+)/14467855-14467878  gggggccgg- ---------- ---------- ---------- -----agaca


                                  51                                                 100
rice-3(+)/16598648-16598707       ggccacgtgg
wild_rice-3(+)/14467855-14467878  ggccacgtgg

STOCKHOLM format

# STOCKHOLM 1.0

#=GF ID NoName
#=GS rice-3(+)/16598648-16598707AC unknown
#=GS wild_rice-3(+)/14467855-14467878AC unknown

rice-3(+)/16598648-16598707       ggaggccggccgtctgccatgcgtgagccagacggggcgggccggagacaggccacgtgg
wild_rice-3(+)/14467855-14467878  gggggccgg------------------------------------agacaggccacgtgg
//

FASTA format

>rice-3(+)/16598648-16598707
ggaggccggccgtctgccatgcgtgagccagacggggcgggccggagacaggccacgtgg
>wild_rice-3(+)/14467855-14467878
gggggccgg------------------------------------agacaggccacgtgg

CLUSTALW format

CLUSTAL W(1.81) multiple sequence alignment


rice-3(+)/16598648-16598707      ggaggccggccgtctgccatgcgtgagccagacggggcgggccggagacaggccacgtgg
wild_rice-3(+)/14467855-14467878 gggggccgg------------------------------------agacaggccacgtgg
                                 ** ******   

Note on formats

These data are in clustalw and other format. The scripts used to process these data will recognize these commonly used formats recognized by BioPerl's AlignIO parser. This does not mean that clustalw or some other program are necessarily required to generate the alignment data.

• See this generalized hierarchical whole genome alignment workflow for general information on how whole genome alignment data ca be generated.

Note on the sequence ID syntax

The sequence ID is this clustal file is overloaded to contain information about the species, strand and coordinates. This information is essential:

 rice-3(+)/16598648-16600199
 speciesv-refseq(strand)/start-end

Database Loading Scripts

Split large clustal files into smaller ones

For performance reasons and to avoid overloading the bioperl-based perl scripts, split large clustal files that have many alignments into one alignment/file with the script split_clustal.pl. This is necessary for very large files that would otherwise overload the BioPerl alignment parser.

gunzip my_huge_clustal_file.aln.gz | perl split_clustal.pl /path/to/smaller_alignment_files

Parse the alignments

A suggested method for formatiing alignment data is to parse clustalw format the alignments using the script clustal2hit.pl

perl clustal2hit.pl /path/to/smaller_alignment_files/*.aln |gzip -c >processed_alignments.txt.gz

There is also a script for processing mercator alignments (mercatoraln_to_synhits.pl) and a generic version (aln2hit.pl) for other MSA formats supported by Bio::SeqIO;

• The output of this script is described below

alignment data loading format

• The output of the script is a tab-delimited ad hoc intermediate format that encodes the alignment coordinates plus 1:1 mapping of coordinates within the alignment (to facilitate accurate grid-lines in GBrowse_syn)
• However to get you alignment or syntency data, this the the format currently supported for loading the alignment database.
• Each record is a single line (wrapped here for display only)

#species1       seqid1  start1   end1   strand1  reserved  species2      seqid2         start2   end2  strand2 reserved \
# pos1-1  pos1-2  ...  posn-1  posn-2  |  pos1-2  pos1-1  ...  posn-2  posn-1
c_briggsae      chrI    1583997 1590364 +       .       c_remanei       Crem_Contig24   631879  634679  -       .       \
1584000 634676  1584100 634584  (truncated...)  |     631900  1590333 632000  1590233  (truncated ...)

Create a mysql database

mysql -uroot -ppassword -e 'create database my_database'

Load the database

load the database with the script load_alignment_database.pl

gunzip -c processed_alignments.txt.gz | perl load_alignment_database.pl

• Once loaded, the data look something like this:

The alignment data

The grid mapping data